dPCR Microbial DNA Detection Assay for Bacteroides ovatus
GeneGlobe ID: DMA00051 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name
Bacteroides ovatus
GeneGlobe Cat.No. (Assay ID)
DMA00051
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Bacteroides ovatus (28116)
Bacteroides fragilis subsp. ovatus
Pasteurella ovata
Pseudobacterium ovatum
Bacteroides fragilis subsp. ovatus
Pasteurella ovata
Pseudobacterium ovatum
Template accession
EU768113.1
Taxonomy
Bacteria
Secondary targets/specificity
Bacteroides koreensis (1912896)
Bacteroides kribbi (1912894)
Bacteroides kribbi (1912894)
Application field
Human Microbiome
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TTAGATACCCTGGTAGTCCACACAGTAAACGATGAATACTCGCTGTTTGCGATATACAGTAAGCGGCCAAGCGAAAGCATTAAGTATTCCACCTGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTAAATTGCAACAGAATATATTGGAAACAGTATAGCCGTAAGGCTGTTGTG
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Bacteroides ovatus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Bacteroides koreensis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Bacteroides ovatus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Bacteroides koreensis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Bacteroides ovatus and elevate your work to new heights.