GeneGlobe ID: DMA00221 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Mycobacterium tuberculosis
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Mycobacterium tuberculosis
GeneGlobe Cat.No. (Assay ID)
DMA00221
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Mycobacterium tuberculosis (1773)
Bacillus tuberculosis
Bacterium tuberculosis
Mycobacterium tuberculosis typus humanus
Mycobacterium tuberculosis var. hominis
Mycobacterium tuberculosis (Zopf 1883) Lehmann and Neumann 1896 (Approved Lists 1980)
Bacillus tuberculosis
Bacterium tuberculosis
Mycobacterium tuberculosis typus humanus
Mycobacterium tuberculosis var. hominis
Mycobacterium tuberculosis (Zopf 1883) Lehmann and Neumann 1896 (Approved Lists 1980)
Template accession
NC_002755.2
Taxonomy
Bacteria
Secondary targets/specificity
Mycobacterium canetti (78331)
Mycobacterium canettii
Mycobacterium canettii
Application field
Human Pathogens
Wet-lab tested in singleplex
Yes, tested dye - HEX
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
GGGAGTGTTTGGGTTTTGTTTGGAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGGAAAGGTCTCTTCGGAGATACTCGAGTGGCGAACGGGTGAGTAACACGTGGGTGATCTGCCCTGCACTTCGGGATAAGCCTGGGAAACTGGGTCTAATACCGGATAGGACCACGGGATGCATGTCTTGTGGTGGAAA
Reaction size
200rxns
Product Resources
File Size: 239.09 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Mycobacterium tuberculosis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with [Haemophilus] ducreyi models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Mycobacterium tuberculosis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for [Haemophilus] ducreyi studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Mycobacterium tuberculosis and elevate your work to new heights.