GeneGlobe ID: DMA00226 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Neisseria bacilliformis
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name
Neisseria bacilliformis
GeneGlobe Cat.No. (Assay ID)
DMA00226
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Neisseria bacilliformis (267212)
Template accession
DQ117530.1
Taxonomy
Bacteria
Application field
Human Pathogens
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
AACACATGCAAGTCGGACGGCAGCACAGAGAAGCTTGCTTCTTGGGTGGCGAGTGGCGAACGGGTGAGTAACGCATCGGAACGTACCGAGTAATGGGGGATAACTGTCCGAAAGGACAGCTAATACCGCATACGCCCTGAGGGGGAAAGCGGGGGATCTTAGGACCTCGCGTTATTCGAGCGGCCGATGTCTG
Reaction size
200rxns
Resources
Available Product Catalog (2)
빠른 시작 프로토콜 (1)
애플리케이션 노트 (2)
기술 정보 (1)
키트 안내서 (1)
과학 포스터 (1)
브로셔 및 가이드 (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Brochures & Guides (2)
Application Notes (2)
Scientific Posters (1)
Technical Information (1)
Kit Handbooks (1)
Quick-Start Protocols (1)
Introducing the dPCR Microbial DNA Detection Assay for Neisseria bacilliformis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Neisseria bacilliformis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Neisseria bacilliformis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Neisseria bacilliformis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Neisseria bacilliformis and elevate your work to new heights.