GeneGlobe ID: DMA00233 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Neisseria sicca
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name
Neisseria sicca
GeneGlobe Cat.No. (Assay ID)
DMA00233
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Neisseria sicca (490)
Neisseria sicca (von Lingelsheim 1908) Bergey et al. 1923 (Approved Lists 1980)
Neisseria sicca (von Lingelsheim 1908) Bergey et al. 1923 (Approved Lists 1980)
Template accession
AJ239301.1
Taxonomy
Bacteria
Secondary targets/specificity
Neisseria flava (34026)
Neisseria mucosa (488)
Neisseria mucosa (von Lingelsheim 1906) Veron et al. 1959
Neisseria macacae (496)
Neisseria mucosa (488)
Neisseria mucosa (von Lingelsheim 1906) Veron et al. 1959
Neisseria macacae (496)
Application field
Human Microbiome
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
GAGGAAGAAAGCAGGGGACCATTTGGCCTTGCGCTGTTTGAGCGGCCGATATCTGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCAGTAGCGGGTCTGAGAGGATGATCCGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTCTGAAGAAGGCCTTCGGGTTGTAAAGGACTTTTGTCAGGGAAGAAAAGGGCGGGGTTAATACCCCTGTCTGATGACGGTACCTGAAGAATAAGCACCGG
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Neisseria sicca, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Neisseria flava models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Neisseria sicca facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Neisseria flava studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Neisseria sicca and elevate your work to new heights.