GeneGlobe ID: DMA00281 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Pseudoramibacter alactolyticus
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name
Pseudoramibacter alactolyticus
GeneGlobe Cat.No. (Assay ID)
DMA00281
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Pseudoramibacter alactolyticus (113287)
Eubacterium alactolyticum
Ramibacterium alactolyticum
Ramibacterium dentium
Ramibacterium pleuriticum
Eubacterium alactolyticum
Ramibacterium alactolyticum
Ramibacterium dentium
Ramibacterium pleuriticum
Template accession
AB036761.1
Taxonomy
Bacteria
Application field
Infectious Diseases
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TAACGCGTGGGCAACCTACCTATCGGAGCGGGATAGCCTCGAGAAATCGGGAGTAAAACCGCATAACACGGATATATCGCATGATGAATCCGTCAAAACTCCGGTGCCGATAGATGGGCCCGCGTCTG
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Pseudoramibacter alactolyticus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Pseudoramibacter alactolyticus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Pseudoramibacter alactolyticus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Pseudoramibacter alactolyticus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Pseudoramibacter alactolyticus and elevate your work to new heights.