GeneGlobe ID: DMA00302 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Staphylococcus aureus
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Staphylococcus aureus
GeneGlobe Cat.No. (Assay ID)
DMA00302
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Staphylococcus aureus (1280)
Micrococcus aureus
Micrococcus pyogenes
Staphlococcus pyogenes citreus
Staphylococcus aureus subsp. anaerobius
Staphylococcus pyogenes aureus
Micrococcus aureus
Micrococcus pyogenes
Staphlococcus pyogenes citreus
Staphylococcus aureus subsp. anaerobius
Staphylococcus pyogenes aureus
Template accession
NZ_ACOT01000039.1
Taxonomy
Bacteria
Secondary targets/specificity
Staphylococcus epidermidis (1282)
Albococcus epidermidis
Micrococcus epidermidis
Staphylococcus epidermidis albus
Staphylococcus argenteus (985002)
Staphylococcus aureus clonal complex 75
Staphylococcus singaporensis (2742142)
Albococcus epidermidis
Micrococcus epidermidis
Staphylococcus epidermidis albus
Staphylococcus argenteus (985002)
Staphylococcus aureus clonal complex 75
Staphylococcus singaporensis (2742142)
Application field
Human Pathogens
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - HEX
Wet-lab tested in multiplex
Yes
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TTTCTGATTAGGTACCGTCAAGATGTGCACAGTTACTTACACATATGTTCTTCCCTAATAACAGAGTTTTACGATCCGAAGACCTTCATCACTCACGCGGCGTTGCTCCGTCAGGCTTTCGCCCATTGCGGAAGATTCCCTACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCCGATCACCCTCTCAGGTCGGCTATGCATCGTTGCCTTGGTAAGCCGTTACCTTACCAACTAGCTAATGCAGCGCGGATCCATCTATAAGTGACAGCAAGACCGTCTTTCACTTTTGAACCATGCGGTTCAAAATATTATCCGGTATTAGCTCCGGTTTCCCGAAGTTA
Reaction size
200rxns
Product Resources
File Size: 263.68 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Staphylococcus aureus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Aspergillus awamori models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Staphylococcus aureus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Aspergillus awamori studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Staphylococcus aureus and elevate your work to new heights.