GeneGlobe ID: DMA00314 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Streptococcus infantis
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name
Streptococcus infantis
GeneGlobe Cat.No. (Assay ID)
DMA00314
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Streptococcus infantis (68892)
Template accession
GQ056832.1
Taxonomy
Bacteria
Secondary targets/specificity
Streptococcus mitis (28037)
Streptococcus oralis (1303)
Streptococcus oralis Bridge and Sneath 1982
Streptococcus cristatus (45634)
Streptococcus crista
Streptococcus oligofermentans
Streptococcus pseudopneumoniae (257758)
Streptococcus salivarius (1304)
Streptococcus salivarius subsp. salivarius
Streptococcus pneumoniae (1313)
Diplococcus pneumoniae
Micrococcus pneumoniae
Streptococcus oralis (1303)
Streptococcus oralis Bridge and Sneath 1982
Streptococcus cristatus (45634)
Streptococcus crista
Streptococcus oligofermentans
Streptococcus pseudopneumoniae (257758)
Streptococcus salivarius (1304)
Streptococcus salivarius subsp. salivarius
Streptococcus pneumoniae (1313)
Diplococcus pneumoniae
Micrococcus pneumoniae
Application field
Human Pathogens
Human Microbiome
Human Microbiome
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TAGAACGCTGAAGGAGGAGCTTGCTCTTCTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTGGTAGCGGGGGATAACTATTGGAAACGATAGCTAATACCGCATAACAGTAGATATC
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Streptococcus infantis, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Streptococcus cristatus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Streptococcus infantis facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Streptococcus cristatus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Streptococcus infantis and elevate your work to new heights.