GeneGlobe ID: DMA00384 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Latilactobacillus curvatus
Product Specification
Bacterial detection assay targeting the phenylalanyl-tRNA synthase alpha subunit (pheS) gene
Alternative names of species: Lactobacillus curvatus
Alternative names of species: Lactobacillus curvatus
Product name
Latilactobacillus curvatus
GeneGlobe Cat.No. (Assay ID)
DMA00384
Target type
Microbial Id
Target region
Phenylalanyl-tRNA synthase alpha subunit (pheS) gene
Target (NCBI taxonomy ID)
Latilactobacillus curvatus (28038)
Bacterium curvatum
Lactobacillus curvatus
Bacterium curvatum
Lactobacillus curvatus
Template accession
AM284232.1
Taxonomy
Bacteria
Application field
Probiotics
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TTCTATCAAATGGAAGGCCAAGTGATTGATAAAAACATTACAATGGCAGACTTAAAGGGAACCTTAGAATACACGATTCACCATATTTTTGGTGAAGACCGTGATTTACGTTTCCG
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Latilactobacillus curvatus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Latilactobacillus curvatus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Latilactobacillus curvatus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Latilactobacillus curvatus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Latilactobacillus curvatus and elevate your work to new heights.