GeneGlobe ID: DMA00389 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Pediococcus damnosus
Product Specification
Bacterial detection assay targeting the ribosomal protein L2P (rplB) gene
Product name
Pediococcus damnosus
GeneGlobe Cat.No. (Assay ID)
DMA00389
Target type
Microbial Id
Target region
Ribosomal protein L2P (rplB) gene
Target (NCBI taxonomy ID)
Pediococcus damnosus (51663)
Template accession
EU331293.1
Taxonomy
Bacteria
Application field
Food Production
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
GACGATGTTGCTGCAACAGTTAAAGCTATCGAATATGATCCAAATCGAACTGCTAATATCGCCTTAATTGGTTACGATGATGGTACTAAAGCATATATCATTGCACCAAAAGGATTGAAGGTTGGAGA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Pediococcus damnosus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Pediococcus damnosus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Pediococcus damnosus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Pediococcus damnosus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Pediococcus damnosus and elevate your work to new heights.