GeneGlobe ID: DMA00414 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Mycobacteroides abscessus
Product Specification
Bacterial detection assay targeting an intergenic spacer region
Alternative names of species: Mycobacterium abscessus
Alternative names of species: Mycobacterium abscessus
Product name
Mycobacteroides abscessus
GeneGlobe Cat.No. (Assay ID)
DMA00414
Target type
Microbial Id
Target region
Intergenic spacer region
Target (NCBI taxonomy ID)
Mycobacteroides abscessus (36809)
Mycobacterium abscessus
Mycobacterium chelonae subsp. abscessus
Mycobacterium chelonei subsp. abscessus
Mycobacterium abscessus
Mycobacterium chelonae subsp. abscessus
Mycobacterium chelonei subsp. abscessus
Template accession
KC352862.1
Taxonomy
Bacteria
Application field
Infectious Diseases
Multiple Drug Resistance
Multiple Drug Resistance
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
GCGCGTCTGGCCTGGGGGCGTTGTTACCCAATCGATAGCACTGTGACAGAAGTGGCCAGTGTGAATCTTGATTAGAATGGCGTACGCGTGGCCGACCGGGGGAGAGATGCGGCCGGAGTGAGAAGGGCTGCTGGACATGAGGTCATCTGGGCGACGGA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Mycobacteroides abscessus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Mycobacteroides abscessus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Mycobacteroides abscessus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Mycobacteroides abscessus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Mycobacteroides abscessus and elevate your work to new heights.