GeneGlobe ID: DMA00638 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for iap
Product Specification
Virulence gene detection assay targeting the bacterial invasion associated endopeptidase (iap) gene
Product name
iap
GeneGlobe Cat.No. (Assay ID)
DMA00638
Target type
Virulence
Target region
Bacterial invasion associated endopeptidase (iap) gene
Target (NCBI taxonomy ID)
P60 extracellular protein, invasion associated protein Iap
Template accession
X52268.1
Taxonomy
Virulence Genes
Application field
Microbial Virulence
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TGGTAACGGACCAACTACATTTGATTGCTCTGGTTACACTAAATATGTATTTGCTAAAGCGGGAATCTCCCTTCCACGTACTTCTGGCGCACAATACGCTAGCACTACAAGAATCTCTGAATCTCAAGCAAAACCTGGTGATTTAGTATTCTTTGACTATGGTAGCGGAATTTCTCACGTTGGTATCTACGT
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for iap, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with P60 extracellular protein, invasion associated protein Iap models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for iap facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for P60 extracellular protein, invasion associated protein Iap studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for iap and elevate your work to new heights.