GeneGlobe ID: DMA00642 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for invA
Product Specification
Virulence gene detection assay targeting the bacterial type III secretion system export apparatus protein InvA gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
invA
GeneGlobe Cat.No. (Assay ID)
DMA00642
Target type
Virulence
Target region
Bacterial type III secretion system export apparatus protein InvA gene
Target (NCBI taxonomy ID)
invasion protein
Template accession
CP002614.1
Taxonomy
Virulence Genes
Application field
Microbial Virulence
Wet-lab tested in singleplex
Yes, tested dye - ROX
Wet-lab tested in multiplex
Yes
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
GGCATCCGCATCAATAATACCGGCCTTCAAATCGGCATCAATACTCATCTGTTTACCGGGCATACCATCCAGAGAAAATCGGGCCGCGACTTCCGCGACACGTTCTGAACCTTTGGTAATAACGATAAACTGGACCACGGTGACAATAGAGAAGA
Reaction size
200rxns
Product Resources
File Size: 256.5 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for invA, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with endocarditis specific antigen models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for invA facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for endocarditis specific antigen studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for invA and elevate your work to new heights.