GeneGlobe ID: DMA00699 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Escherichia coli (rfbE)
Product Specification
Bacterial detection assay targeting the GDP-perosamine synthase RFbE/PerA gene
Product name
Escherichia coli (rfbE)
GeneGlobe Cat.No. (Assay ID)
DMA00699
Target type
Microbial Id
Target region
GDP-perosamine synthase RFbE/PerA gene
Target (NCBI taxonomy ID)
Escherichia coli (562)
Bacillus coli
Bacterium coli commune
Bacterium coli
E. coli
Enterococcus coli
Escherichia/Shigella coli
Bacillus coli
Bacterium coli commune
Bacterium coli
E. coli
Enterococcus coli
Escherichia/Shigella coli
Template accession
CP038425.1
Taxonomy
Bacteria
Application field
Human Microbiome
Wastewater & Drinking Water Epidemiology
Wastewater & Drinking Water Epidemiology
Wet-lab tested in singleplex
No
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
No
Additional assay information
Assay based on proven sequences of mericon qPCR system
Region of Interest
GAAAGTAAAGATGTTTTTCACACTTATTGGATGGTCTCAATTCTAACTAGGACCGCAGAGGAAAGAGAGGAATTAAGGAATCACCTTGCAGATAAACTCATCGAAACAAGGCCAGTTTT
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Escherichia coli (rfbE), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Escherichia coli models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Escherichia coli (rfbE) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Escherichia coli studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Escherichia coli (rfbE) and elevate your work to new heights.