GeneGlobe ID: DMA00706 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Legionella pneumophila (2)
Product Specification
Bacterial detection assay targeting the macrophage infectivity potentiator (mip) surface protein gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Legionella pneumophila (2)
GeneGlobe Cat.No. (Assay ID)
DMA00706
Target type
Microbial Id
Target region
Macrophage infectivity potentiator (mip) surface protein gene
Target (NCBI taxonomy ID)
Legionella pneumophila (446)
Template accession
CP045974.1
Taxonomy
Bacteria
Application field
Environmental Microbes
Infectious Diseases
Infectious Diseases
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
No
Additional assay information
Assay based on proven sequences of mericon qPCR system
Region of Interest
GGATAAGTTGTCTTATAGCATTGGTGCCGATTTGGGGAAGAATTTTAAAAATCAAGGCATAGATGTTAATCCGGAAGCAATGGCTAAAGGCATGCAAGACGCTATGAGTGGCGCTCAATTGGC
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Legionella pneumophila (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Legionella pneumophila models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Legionella pneumophila (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Legionella pneumophila studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Legionella pneumophila (2) and elevate your work to new heights.