dPCR Microbial DNA Detection Assay for Legionella pneumophila (2)

GeneGlobe ID: DMA00706 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the macrophage infectivity potentiator (mip) surface protein gene
dPCR wet-lab verified
Product name​
Legionella pneumophila (2)
GeneGlobe Cat.No. (Assay ID)​
DMA00706
Target type​
Microbial Id
Target region​
Macrophage infectivity potentiator (mip) surface protein gene
Target (NCBI taxonomy ID)​
Legionella pneumophila (446)
Template accession​
CP045974.1
Taxonomy​
Bacteria
Application field​
Environmental Microbes
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
No
Additional assay information​
Assay based on proven sequences of mericon qPCR system
Region of Interest​
GGATAAGTTGTCTTATAGCATTGGTGCCGATTTGGGGAAGAATTTTAAAAATCAAGGCATAGATGTTAATCCGGAAGCAATGGCTAAAGGCATGCAAGACGCTATGAGTGGCGCTCAATTGGC
Reaction size​
200rxns

Microbiology Research Areas

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Legionella pneumophila (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Legionella pneumophila models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Legionella pneumophila (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Legionella pneumophila studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Legionella pneumophila (2) and elevate your work to new heights.