dPCR Microbial DNA Detection Assay for African swine fever virus
GeneGlobe ID: DMA00716 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Viral detection assay
Alternative names of species: ASFV
dPCR wet-lab validated
Alternative names of species: ASFV
dPCR wet-lab validated
Product name
African swine fever virus
GeneGlobe Cat.No. (Assay ID)
DMA00716
Target type
Microbial Id
Target (NCBI taxonomy ID)
African swine fever virus (10497)
African swine fever virus ASF
African swine fever virus ASFV
African swine fever virus, ASFV
ASFV
African swine fever virus ASF
African swine fever virus ASFV
African swine fever virus, ASFV
ASFV
Template accession
B646L
Taxonomy
Viruses
Application field
Animal Disease
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
Yes
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI
Template present in Microbial DNA Positive Control
No
Region of Interest
GCCCTACCATCTCATGTGGAAGTATTATGAAACGCGAGACAGTGAAAAGATGGCCGACGTGGCCTACTACTGCATTATAGATGCCCAGCGCTGTCAGGACCTTCTGGTGCGCCACAATGTTATCCCCGATCG
Reaction size
200rxns
Product Resources
File Size: 97.25 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for African swine fever virus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with African swine fever virus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for African swine fever virus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for African swine fever virus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for African swine fever virus and elevate your work to new heights.