dPCR Microbial DNA Detection Assay for tetA(C)
GeneGlobe ID: DMA00769 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Bacterial detection assay
Alternative names of species: tetracyclin efflux pump, tetracycline resistance protein, ampicillin and tetracycline resistance
dPCR wet-lab verified
Alternative names of species: tetracyclin efflux pump, tetracycline resistance protein, ampicillin and tetracycline resistance
dPCR wet-lab verified
Product name
tetA(C)
GeneGlobe Cat.No. (Assay ID)
DMA00769
Target type
Antibiotics Resistance
Target region
tetA(C)
Target (NCBI taxonomy ID)
tetA(C)
Template accession
MN370019.1
Taxonomy
Resistance Genes
Application field
Antibiotic Resistance (AMR)
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI
Template present in Microbial DNA Positive Control
No
Region of Interest
GTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCATTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATG
Reaction size
200rxns
Product Resources
File Size: 83.41 KBLanguage: English
Resources
Available Product Catalog (2)
Brochures and Guides (2)
Kit Handbooks (1)
Protocols (3)
Scientific Posters (1)
Technical Information (1)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for tetA(C), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with tetA(C) models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for tetA(C) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for tetA(C) studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for tetA(C) and elevate your work to new heights.