GeneGlobe ID: DMA00798 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Starmerella stellata
Product Specification
Yeast detection assay
Alternative names of species: Candida stellata, Saccharomyces stellatus
dPCR wet-lab validated
Alternative names of species: Candida stellata, Saccharomyces stellatus
dPCR wet-lab validated
Product name
Starmerella stellata
GeneGlobe Cat.No. (Assay ID)
DMA00798
Target type
Microbial Id
Target (NCBI taxonomy ID)
Starmerella stellata (45594)
Candida stellata
Saccharomyces stellatus
Candida stellata
Saccharomyces stellatus
Template accession
NR_155771.1
Taxonomy
Plants and Fungi
Application field
Food Production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
TTGAATTTTTGAACGCATATTGCGCCATTAGGTCTTCCTAATGGCATGCTTGTTGGAGCGTCGATCTTCCTCTCAACCATTCTTTGGTATGAGGTCTTGCTCCTTTTAGGAGTGAAAATCATGGAAGTGCACACGTTAATTAACTTTGTGCAGTTACTCTCAACTTTTGACCCCC
Reaction size
200rxns
Product Resources
File Size: 87.43 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Starmerella stellata, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Starmerella stellata models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Starmerella stellata facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Starmerella stellata studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Starmerella stellata and elevate your work to new heights.