dPCR Microbial DNA Detection Assay for Trichophyton indotinae
GeneGlobe ID: DMA00812 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
Product Specification
Fungi detection assay
Alternative names of species: Trichophyton mentagrophytes var. Indotineae
dPCR wet-lab validated
Alternative names of species: Trichophyton mentagrophytes var. Indotineae
dPCR wet-lab validated
Product name
Trichophyton indotinae
GeneGlobe Cat.No. (Assay ID)
DMA00812
Target type
Microbial Id
Target (NCBI taxonomy ID)
Trichophyton indotineae (2739387)
Trichophyton mentagrophytes var. indotineae
Trichophyton mentagrophytes var. indotineae
Template accession
NR_173767.1
Taxonomy
Plants and Fungi
Application field
Tropical & Vector-borne Diseases
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
CGCCGGCCGTACCGCCCCATTCTTGTCTACCTTACTCGGTTGCCTCGGCGGGCCGCGCTCTTCCAGGAGAGCCGTTCGGCGAGCCTCTCTTTAGTGGCTAAACGCTGGACCGCGCCCGCCGGAG
Reaction size
200rxns
Product Resources
File Size: 90.19 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Trichophyton indotinae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Trichophyton indotineae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Trichophyton indotinae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Trichophyton indotineae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Trichophyton indotinae and elevate your work to new heights.