GeneGlobe ID: DMA00814 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Cauliflower mosaic virus
Product Specification
Viral detection assay
Alternative names of species: CaMV, CAMV
dPCR wet-lab validated
Alternative names of species: CaMV, CAMV
dPCR wet-lab validated
Product name
Cauliflower mosaic virus
GeneGlobe Cat.No. (Assay ID)
DMA00814
Target type
Microbial Id
Target (NCBI taxonomy ID)
Cauliflower mosaic virus (10641)
CAMV
cauliflower mosaic virus CaMV
CAMV
cauliflower mosaic virus CaMV
Template accession
NC_001497.2
Taxonomy
Viruses
Application field
Food Production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
TTAACTTAGGAAAATACTCTTACCCCAATTACGGAGTAGGAAATGAAGAATTAGGATCCTCTGGAAACCCTAAAGCTTTAACCTGGCCCTTCAAAGCTCCAGCAGGATGGCCGAATCAATTTTAGACAGAACCATTAATAGG
Reaction size
200rxns
Product Resources
File Size: 86.52 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Cauliflower mosaic virus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Cauliflower mosaic virus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Cauliflower mosaic virus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Cauliflower mosaic virus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Cauliflower mosaic virus and elevate your work to new heights.