GeneGlobe ID: DMA00821 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Starmerella bacillaris
Product Specification
Yeast detection assay
Alternative names of species: Saccharomyces bacillaris, Torulopsis bacillaris, Cryptococcus bacillaris, Candida cf. stellata 10-372
Candida cf. stellata 10-373
Candida cf. stellata 10-374
Candida cf. stellata 10-375
Candida sp. EJ1
dPCR wet-lab validated
Alternative names of species: Saccharomyces bacillaris, Torulopsis bacillaris, Cryptococcus bacillaris, Candida cf. stellata 10-372
Candida cf. stellata 10-373
Candida cf. stellata 10-374
Candida cf. stellata 10-375
Candida sp. EJ1
dPCR wet-lab validated
Product name
Starmerella bacillaris
GeneGlobe Cat.No. (Assay ID)
DMA00821
Target type
Microbial Id
Target region
ITS
Target (NCBI taxonomy ID)
Starmerella bacillaris (1247836)
Candida zemplinina
Cryptococcus bacillaris
Saccharomyces bacillaris
Torulopsis bacillaris
Candida zemplinina
Cryptococcus bacillaris
Saccharomyces bacillaris
Torulopsis bacillaris
Template accession
MN915121.1
Taxonomy
Plants and Fungi
Application field
Food Production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI
Template present in Microbial DNA Positive Control
No
Region of Interest
CGGTCTTTGCAATTGCTTGGGTGTCGAAAGGCGCCCAATCTTTAAAACTTTTATATTTGTTCTGAAACAATGAAAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATTTTTGAACGCATATTGCGCTATTAGTTTGTCT
Reaction size
200rxns
Product Resources
File Size: 88.45 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Starmerella bacillaris, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Starmerella bacillaris models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Starmerella bacillaris facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Starmerella bacillaris studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Starmerella bacillaris and elevate your work to new heights.