GeneGlobe ID: DMA00838 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6B
Product Specification
Viral detection assay
Alternative names of species: HHV-6B, human B-lymphothrophic virus, HBLV, human herpesvirus 6B, human betaherpesvirus 6B
dPCR wet-lab validated
Alternative names of species: HHV-6B, human B-lymphothrophic virus, HBLV, human herpesvirus 6B, human betaherpesvirus 6B
dPCR wet-lab validated
Product name
Human betaherpesvirus 6B
GeneGlobe Cat.No. (Assay ID)
DMA00838
Target type
Microbial Id
Target region
U90
Target (NCBI taxonomy ID)
Human betaherpesvirus 6B (32604)
Human herpes virus 6B
Human herpesvirus 6B
Human herpesvirus 6 type B
Human herpes virus 6B
Human herpesvirus 6B
Human herpesvirus 6 type B
Template accession
AB021506.1
Taxonomy
Viruses
Application field
Herpes Panel
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
Yes
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
TTGTCTATTTTACTTTCTGGATTTAAAGTATCCTGAATTGCATCATGACTTTTGACAGGAGTTGCTGAGTCGGTAAAGGTCATACAAGGAAGCGTTTCGGTACACTTGGAGTTAGAACCTTTTTCCTGAATCCTTTCTTTTGTCTGTGACCTTTGATCGGGGCTGTAAGCCAA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6B, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Betapolyomavirus macacae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6B facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Betapolyomavirus macacae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human betaherpesvirus 6B and elevate your work to new heights.