GeneGlobe ID: DMA00850 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Campylobacter jejuni
Product Specification
Bacterial detection assay
Alternative names of species: Vibrio coli, Campylobacter coli, Campylobacter lari
dPCR wet-lab validated
Alternative names of species: Vibrio coli, Campylobacter coli, Campylobacter lari
dPCR wet-lab validated
Product name
Campylobacter jejuni
GeneGlobe Cat.No. (Assay ID)
DMA00850
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Campylobacter lari (201)
Campylobacter laridis
Campylobacter jejuni (197)
Campylobacter fetus subsp. jejuni
Vibrio hepaticus
Vibrio jejuni
Campylobacter coli (195)
Campylobacter hyoilei
Vibrio coli
Campylobacter laridis
Campylobacter jejuni (197)
Campylobacter fetus subsp. jejuni
Vibrio hepaticus
Vibrio jejuni
Campylobacter coli (195)
Campylobacter hyoilei
Vibrio coli
Taxonomy
Bacteria
Application field
Food Testing
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Additional assay information
Assay based on proven sequences of mericon qPCR system
Region of Interest
CTGCTTAACACAAGTTGAGTAGGGAAAGTTTTTCGGTGTAGGATGAGACTATATAGTATCAGCTAGTTGGTAAGGTAATGGCTTACCAAGGCTATGACGCTTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTAGGGAATATTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGGAGGATGACACTTTTCGGAGCGTAAACTCCTTTTCTTAGGG
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Campylobacter jejuni, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Campylobacter coli models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Campylobacter jejuni facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Campylobacter coli studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Campylobacter jejuni and elevate your work to new heights.