GeneGlobe ID: DMA00875 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Orthomarburgvirus marburgense Pan (2/2)
Product Specification
Viral detection assay. For full pan coverage use in one reaction with DMA00874, both assays labelled with same fluorophore
Alternative names of species: Marburg marburgvirus, Lake Victoria marburgvirus, Marburg virus MBG
dPCR wet-lab validated
Alternative names of species: Marburg marburgvirus, Lake Victoria marburgvirus, Marburg virus MBG
dPCR wet-lab validated
Product name
Orthomarburgvirus marburgense Pan (2/2)
GeneGlobe Cat.No. (Assay ID)
DMA00875
Target type
Microbial Id
Target (NCBI taxonomy ID)
Orthomarburgvirus marburgense (3052505)
Lake Victoria marburgvirus
Marburg marburgvirus
Marburg virus MBG
MBG
Lake Victoria marburgvirus
Marburg marburgvirus
Marburg virus MBG
MBG
Template accession
EF446132.1 (CI67)
Taxonomy
Viruses
Application field
Human Pathogens
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
AAAAGTTGCTGATTCCCCTTTGGAGGCATCCAAGCGATGGGCTTTCAGGACAGGTGTACCTCCCAAGAATGTTGAGTATACAGAAGGGGAGGAA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Orthomarburgvirus marburgense Pan (2/2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Orthomarburgvirus marburgense models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Orthomarburgvirus marburgense Pan (2/2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Orthomarburgvirus marburgense studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Orthomarburgvirus marburgense Pan (2/2) and elevate your work to new heights.