GeneGlobe ID: DMA00894 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Betapolyomavirus hominis, (BKV)
Product Specification
Viral detection assay
Alternative names of species: Human polyomavirus 1, BK polyomavirus, BK virus, BK virus BKV, Human polyomavirus (type BK), Human polyomavirus BK, Human polyomavirus BKV, Papovavirus BKV, human polyomavirus type BK BKV, polyomavirus BK, BKPyV
dPCR wet-lab validated
Alternative names of species: Human polyomavirus 1, BK polyomavirus, BK virus, BK virus BKV, Human polyomavirus (type BK), Human polyomavirus BK, Human polyomavirus BKV, Papovavirus BKV, human polyomavirus type BK BKV, polyomavirus BK, BKPyV
dPCR wet-lab validated
Product name
Betapolyomavirus hominis, (BKV)
GeneGlobe Cat.No. (Assay ID)
DMA00894
Target type
Microbial Id
Target region
Target (NCBI taxonomy ID)
Betapolyomavirus hominis (1891762)
BK polyomavirus
BKV
BK virus BKV
BK virus
Human polyomavirus 1
Human polyomavirus BK
Human polyomavirus BKV
human polyomavirus type BK BKV
Human polyomavirus (type BK)
Papovavirus BKV
polyomavirus BK
Polyomavirus hominis 1
BK polyomavirus
BKV
BK virus BKV
BK virus
Human polyomavirus 1
Human polyomavirus BK
Human polyomavirus BKV
human polyomavirus type BK BKV
Human polyomavirus (type BK)
Papovavirus BKV
polyomavirus BK
Polyomavirus hominis 1
Template accession
KT896312.1
Taxonomy
Viruses
Application field
Human Pathogens
Transplantation
Transplantation
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
AACTTCACAAGAATTGCAAAGAAGAACAGAGAGATTCTTTAGAGACTCCTTGGCTAGATTTTTGGAAGAAACTACCTGGACAATTGTAAATGCCCCTGTAAACTTTTATAATTATATTCAAGAATATTATTCTGATCTTTCCCCTATTAGGCCCTCAATGGTTAGACAAGTTGC
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Betapolyomavirus hominis, (BKV), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Betapolyomavirus hominis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Betapolyomavirus hominis, (BKV) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Betapolyomavirus hominis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Betapolyomavirus hominis, (BKV) and elevate your work to new heights.