GeneGlobe ID: DMA00937 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Human Papillomavirus 18 (2)
Product Specification
Viral detection assay
Alternative names of species: Human papillomavirus-18, Human papilloma virus type 18, Human papillomavirus type 18, HPV18
dPCR wet-lab validated
Alternative names of species: Human papillomavirus-18, Human papilloma virus type 18, Human papillomavirus type 18, HPV18
dPCR wet-lab validated
Product name
Human Papillomavirus 18 (2)
GeneGlobe Cat.No. (Assay ID)
DMA00937
Target type
Microbial Id
Target region
E6
Target (NCBI taxonomy ID)
human papillomavirus 18 (333761)
Human papilloma virus type 18
Human papillomavirus type 18
HPV18
HPV-18
Human papilloma virus type 18
Human papillomavirus type 18
HPV18
HPV-18
Template accession
AY262282.1
Taxonomy
Viruses
Application field
Human Pathogens
Infectious Diseases
Sexually Transmitted Infections (STI)
Infectious Diseases
Sexually Transmitted Infections (STI)
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
CACAATACTATGGCGCGCTTTGAGGATCCAACACGGCGACCCTACAAGCTACCTGATCTGTGCACGGAACTGAACACTTCACTGCAAGACATAGAAATAA
Reaction size
200rxns
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human Papillomavirus 18 (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with human papillomavirus 18 models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human Papillomavirus 18 (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for human papillomavirus 18 studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human Papillomavirus 18 (2) and elevate your work to new heights.