The following mature miRNA have the same seed sequence: UGCAUUG
| ID | hsa-miR-33a-5p |
| Accession | MIMAT0000091 |
| Sequence | 6 - GUGCAUUGUAGUUGCAUUGCA - 26 |
| Seed Sequence | UGCAUUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
disease
- non-insulin-dependent diabetes mellitus
- experimental autoimmune encephalomyelitis
- HER2 negative hormone receptor negative breast cancer
- pilocarpine-induced status epilepticus
- idiopathic pulmonary fibrosis
- nonobstructive azoospermia
- chronic epilepsy