The following mature miRNA have the same seed sequence: UUUGCGA
| ID | hsa-miR-450a-5p |
| Accession | MIMAT0001545 |
| Sequence | 18 - UUUUGCGAUGUGUUCCUAAUAU - 39 |
| Seed Sequence | UUUGCGA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
disease
- neoplasia
- non-insulin-dependent diabetes mellitus
- diabetes mellitus
- metastatic colorectal cancer
- nonobstructive azoospermia
- colorectal cancer
role in cell
- colony formation by
- cell viability
- expression in
- invasion by
- migration
- anoikis