The following mature miRNA have the same seed sequence: CCUUGGC
| ID | hsa-miR-212-5p |
| Accession | MIMAT0022695 |
| Sequence | 31 - ACCUUGGCUCUAGACUGCUUACU - 53 |
| Seed Sequence | CCUUGGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- MIR124-1HG
- macrophages
- cigarette smoke
- NOLC1
disease
- chronic obstructive pulmonary disease
- gait disturbance
role in cell
- expression in
- proliferation
- cell death
- invasion by
- migration
- cell cycle progression
- colony formation by