The following mature miRNA have the same seed sequence: CUGCAGU
| ID | hsa-miR-17-3p |
| Accession | MIMAT0000071 |
| Sequence | 51 - ACUGCAGUGAAGGCACUUGUAG - 72 |
| Seed Sequence | CUGCAGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
- AGO2
- AGO2/3
disease
- idiopathic pulmonary fibrosis
- diabetes mellitus
- metastatic colorectal cancer
- colorectal cancer
- papillary thyroid carcinoma
- papillary thyroid cancer
- glioma formation
- primary astrocytoma
- primary neoplasia
role in cell
- activation in
- apoptosis
- growth