The following mature miRNA have the same seed sequence: AACGGAA
| ID | hsa-miR-191-5p |
| Accession | MIMAT0000440 |
| Sequence | 16 - CAACGGAAUCCCAAAAGCAGCUG - 38 |
| Seed Sequence | AACGGAA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast cancer
- colorectal cancer
- gastric cancer
- organismal death
- liver cancer
- non-small cell lung cancer
- endometrioid endometrial adenocarcinoma
- endometrioid endometrial cancer
- pancreatic cancer
- prostate cancer
regulates
role in cell
- growth
- formation in
- G2/M phase