The following mature miRNA have the same seed sequence: AUGUGGG
| ID | hsa-miR-299-3p |
| Accession | MIMAT0000687 |
| Sequence | 39 - UAUGUGGGAUGGUAAACCGCUU - 60 |
| Seed Sequence | AUGUGGG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
regulated by
- Oxidized LDL
- vorinostat
disease
- systemic lupus erythematosus
- coronary artery disease
- organismal death
- postmenopausal osteoporosis
- obesity
role in cell
- cell viability
- expression in
- proliferation
- regulation in