The following mature miRNA have the same seed sequence: UCAUAGA
| ID | hsa-miR-376a-3p |
| Accession | MIMAT0000729 |
| Sequence | 44 - AUCAUAGAGGAAAAUCCACGU - 64 |
| Seed Sequence | UCAUAGA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colorectal cancer
- pancreatic cancer
- breast cancer
- pancreatic neoplasia
- pancreatic ductal adenocarcinoma
- pancreatic epithelial cancer
- ductal pancreatic cancer
- experimental autoimmune encephalomyelitis
- soft tissue sarcoma cancer
- congenital adrenal hyperplasia
role in cell
- expression in
- invasion by
- proliferation
- cell viability
- migration
- cisplatin resistance