The following mature miRNA have the same seed sequence: GCUCGGU
| ID | hsa-miR-423-3p |
| Accession | MIMAT0001340 |
| Sequence | 53 - AGCUCGGUCUGAGGCCCCUCAGU - 75 |
| Seed Sequence | GCUCGGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast cancer
- chronic epilepsy
- idiopathic pulmonary fibrosis
- HER2 negative hormone receptor negative breast cancer
- kainic acid-induced epileptic seizure
- nonobstructive azoospermia
- lupus nephritis
- pilocarpine-induced status epilepticus