The following mature miRNA have the same seed sequence: GAGGUAU
| ID | hsa-miR-202-3p |
| Accession | MIMAT0002811 |
| Sequence | 64 - AGAGGUAUAGGGCAUGGGAA - 83 |
| Seed Sequence | GAGGUAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- tumorigenesis
- organismal death
- pancreatic cancer
- colorectal cancer
role in cell
- expression in
- production in
- growth
- colony formation
- generation in