The following mature miRNA have the same seed sequence: AACAAAC
| ID | hsa-miR-495-3p |
| Accession | MIMAT0002817 |
| Sequence | 50 - AAACAAACAUGGUGCACUUCUU - 71 |
| Seed Sequence | AACAAAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colon cancer
- colorectal cancer
- deep vein thrombosis
- melanoma
- melanoma cancer
- severe asthma
- nonobstructive azoospermia
role in cell
- expression in
- cell viability
- proliferation
- apoptosis
- migration
- invasion by
- epithelial-mesenchymal transition
- sub-G1 phase