The following mature miRNA have the same seed sequence: AAGUGCA
| ID | hsa-miR-519a-3p |
| Accession | MIMAT0002869 |
| Sequence | 53 - AAAGUGCAUCCUUUUAGAGUGU - 74 |
| Seed Sequence | AAGUGCA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- lung cancer
- hepatic steatosis
- nonobstructive azoospermia
- small cell lung cancer
- diabetes mellitus
role in cell
- expression in
- proliferation
- activation
- recognition
- senescence
- recognition by