The following mature miRNA have the same seed sequence: ACGCUCA
| ID | hsa-miR-574-3p |
| Accession | MIMAT0003239 |
| Sequence | 61 - CACGCUCAUGCACACACCCACA - 82 |
| Seed Sequence | ACGCUCA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
disease
- colorectal cancer
- breast cancer
- sporadic amyotrophic lateral sclerosis
- HER2 negative hormone receptor negative breast cancer
- small cell lung cancer
- severe asthma
- colorectal adenocarcinoma
- colorectal carcinomagenesis
regulates
role in cell
- expression in
- number
- differentiation