The following mature miRNA have the same seed sequence: CCGAGCC
| ID | hsa-miR-615-3p |
| Accession | MIMAT0003283 |
| Sequence | 61 - UCCGAGCCUGGGUCUCCCUCUU - 82 |
| Seed Sequence | CCGAGCC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- PAX3-FOXO1
- cardiomyocytes
- IDO1
- insulin
disease
- breast cancer
- idiopathic pulmonary fibrosis
- colorectal cancer
- epithelial cancer
- lupus nephritis
- malignant mesothelioma
- mesothelioma formation
role in cell
- apoptosis
- expression in
- proliferation
- phosphorylation in
- G1 phase
- cell viability
- S phase
- gefitinib resistance
- phagocytic capacity