The following mature miRNA have the same seed sequence: ACUAGAU
| ID | hsa-miR-28-3p |
| Accession | MIMAT0004502 |
| Sequence | 54 - CACUAGAUUGUGAGCUCCUGGA - 75 |
| Seed Sequence | ACUAGAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- non-insulin-dependent diabetes mellitus
- breast cancer
- sporadic amyotrophic lateral sclerosis
- LMNA-related congenital muscular dystrophy
role in cell
- expression in
- bortezomib resistance