The following mature miRNA have the same seed sequence: GGAGACG
| ID | hsa-miR-139-3p |
| Accession | MIMAT0004552 |
| Sequence | 43 - UGGAGACGCGGCCCUGUUGGAGU - 65 |
| Seed Sequence | GGAGACG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
binds
disease
- neoplasia
- colorectal cancer
- mammary neoplasm
- T-cell non-Hodgkin disease
- mature T-cell neoplasia
- lung adenocarcinoma
- lung adenocarcinoma formation
- adult T-cell leukemia/lymphoma
role in cell
- proliferation
- expression in
- migration
- invasion by