The following mature miRNA have the same seed sequence: UAUAAAG
| ID | hsa-miR-340-5p |
| Accession | MIMAT0004692 |
| Sequence | 16 - UUAUAAAGCAAUGAGACUGAUU - 37 |
| Seed Sequence | UAUAAAG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast cancer
- neoplasia
- neoplastic cell transformation
- liver cancer
- organismal death
- cervical squamous cell carcinoma
- squamous cell cervical cancer
- postmenopausal osteoporosis
- vulvar melanoma
- vulva cancer
role in cell
- expression in
- proliferation
- quantity
- colony formation
- migration
- invasion by