The following mature miRNA have the same seed sequence: UGCCCUG
| ID | hsa-miR-874-3p |
| Accession | MIMAT0004911 |
| Sequence | 47 - CUGCCCUGGCCCGAGGGACCGA - 68 |
| Seed Sequence | UGCCCUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colorectal cancer
- breast ductal carcinoma in situ
- ductal in situ breast cancer
- papillary thyroid carcinoma
- papillary thyroid cancer
- bipolar disorder
- renal fibrosis
role in cell
- expression in
- growth
- proliferation
- production in
- migration
- cellular infiltration by
- colony formation
- invasion by
- consumption in
- Gap 0-Gap 1 phase