The following mature miRNA have the same seed sequence: CUCAAAA
| ID | hsa-miR-371b-5p |
| Accession | MIMAT0019892 |
| Sequence | 7 - ACUCAAAAGAUGGCGGCACUUU - 28 |
| Seed Sequence | CUCAAAA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- precursor B-cell acute lymphoblastic leukemia
- HER2 negative hormone receptor negative breast cancer
- sporadic amyotrophic lateral sclerosis
- amyotrophic lateral sclerosis
role in cell
- proliferation
- expression in
- migration
- apoptosis
- invasion by