The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-134 |
| Accession | MI0000474 |
| Genome Context | chr14: 101054687-101054759 [+] |
| Associated Mature miRNA | |
| Sequence | CAGGGUGUGUGACUGGUUGACCAGAGGGGCAUGCACUGUGUUCACCCUGUGGGCCACCUAGUCACCAACCCUC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colorectal cancer
- lymphoma
- neoplasia
- schizophrenia
- epithelial cancer
- hepatocellular carcinoma
- liver cancer
- insulinoma
- pancreatic neoplasia
- lung cancer
role in cell
- proliferation
- apoptosis
- growth
- expression in
- migration
- invasion by
- differentiation
- size
- invasion
- osteoclastogenesis