The following mature miRNA have the same seed sequence: GUGACUG
| ID | hsa-miR-134-5p |
| Accession | MIMAT0000447 |
| Sequence | 8 - UGUGACUGGUUGACCAGAGGGG - 29 |
| Seed Sequence | GUGACUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- organismal death
- epithelial cancer
- hepatocellular carcinoma
- liver cancer
- deep vein thrombosis
- lung cancer
- colorectal cancer
- intrahepatic cholestasis of pregnancy
- lupus nephritis
- schizophrenia
role in cell
- apoptosis
- expression in
- proliferation
- differentiation
- osteoclastogenesis
- transmembrane potential
- plasticity