The following mature miRNA have the same seed sequence: ACCCUGU
| ID | hsa-miR-10a-5p |
| Accession | MIMAT0000253 |
| Sequence | 22 - UACCCUGUAGAUCCGAAUUUGUG - 44 |
| Seed Sequence | ACCCUGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colorectal cancer
- breast cancer
- epithelial cancer
- organismal death
- liver cancer
- adult T-cell leukemia/lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- myelodysplastic syndrome with isolated del(5q)
- kainic acid-induced epileptic seizure
role in cell
- apoptosis
- expression in
- activation in
- proliferation
- migration
- invasion by
- molecular cleavage in
- signaling in
- self-renewal