The following mature miRNA have the same seed sequence: UAAAGCU
| ID | hsa-miR-9-3p |
| Accession | MIMAT0000442 |
| Sequence | 55 - AUAAAGCUAGAUAACCGAAAGU - 76 |
| Seed Sequence | UAAAGCU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulated by
- sirolimus
- vorinostat
- CD274
- NT2/D1 cells
- bortezomib
- perifosine
disease
- nonobstructive azoospermia
- schizophrenia
- metastatic colorectal cancer
- Waldenström macroglobulinemia
- experimental autoimmune encephalomyelitis
- endometrioid endometrial adenocarcinoma
- endometrioid endometrial cancer
- endometriosis
- congenital adrenal hyperplasia
- HER2 negative hormone receptor negative breast cancer
role in cell
- expression in
- differentiation
- apoptosis
- growth
- conversion
- sphere formation
- binding in
- autophagy in
- cytotoxic reaction in