The following mature miRNA have the same seed sequence: GAGAACU
| ID | hsa-miR-146a-5p |
| Accession | MIMAT0000449 |
| Sequence | 21 - UGAGAACUGAAUUCCAUGGGUU - 42 |
| Seed Sequence | GAGAACU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast cancer
- diabetes mellitus
- lung cancer
- multiple sclerosis
- Alzheimer disease
- epithelial cancer
- liposarcoma
- soft tissue sarcoma cancer
- primary cancer
- hepatocellular carcinoma
role in cell
- expression in
- proliferation
- phosphorylation in
- apoptosis
- migration
- cell death
- synthesis in
- activation
- activation in
- production in