The following mature miRNA have the same seed sequence: CUGGCUC
| ID | hsa-miR-149-5p |
| Accession | MIMAT0000450 |
| Sequence | 15 - UCUGGCUCCGUGUCUUCACUCCC - 37 |
| Seed Sequence | CUGGCUC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- amyotrophic lateral sclerosis
- metastasis
- gallbladder cancer
- metastatic melanoma
- metastatic melanoma cancer
- primary melanoma
- melanoma cancer
- primary cancer
- cervical squamous cell carcinoma
- squamous cell cervical cancer
role in cell
- expression in
- activation in
- proliferation
- migration
- invasion
- invasion by
- cell spreading
- upregulation in