The following mature miRNA have the same seed sequence: UAUCAGA
| ID | hsa-miR-361-5p |
| Accession | MIMAT0000703 |
| Sequence | 6 - UUAUCAGAAUCUCCAGGGGUAC - 27 |
| Seed Sequence | UAUCAGA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast cancer
- occlusion and stenosis of carotid artery
- glioma
- glioma formation
- vulvar melanoma
- vulva cancer
- lung cancer
- kainic acid-induced epileptic seizure
- HER2 negative hormone receptor negative breast cancer
- adult T-cell leukemia/lymphoma
role in cell
- expression in
- proliferation
- migration
- apoptosis
- cell viability
- invasion by
- colony formation